Screening arthropod DNA samples for Wolbachia

This protocol functions as a guideline for processing of arthropods to determine presence or absence of the intracellular bacteria, Wolbachia.  The general steps are: (step 1) arthropod collection and storage, (step 2) pre-extraction processing, (step 3) DNA extraction and purification from arthropod and Wolbachia, (step 4) determination of infection status and template amplification control, (step 5-optional) typing of Wolbachia strains A and B using two diagnostic PCRs with strain specific primers and/or the restriction profile, (step 6-optional) sequencing of Wolbachia positive arthropod 28s D2 rDNA PCR product for molecular identification of the arthropod, and 16s rRNA, wsp, groEL, or other Wolbachia genes for strain typing in Wolbachia.

Step 1: Specimen Collection and Storage Recommendations (By A. Corthals and J. Feinstein, AMCC)

See also the AMCC website

Dowload the AMCC Collection and accession PowerPoint protocol

Collecting insects to preserve Wolbachia.

The purpose of this document is to provide insect-collecting guidelines that will maximize the chance of detecting Wolbachia infections by PCR screening. The basic advice is that colder is better, and ethanol is better than nothing.

The Ambrose Monell Cryo Collection (AMCC) at the American Museum of Natural History, as part of the Wolbachia-FIBR, is a centralized repository for tissues and DNA. The AMCC provide researchers with collecting kits to readily sample and ship genetic material of high quality, enhancing the genetic information content of each specimen and supports ongoing genetic research by insuring that all research materials are vouchered (i.e. they point back to a specimen in a curated collection). Researchers using the Monell Collection have access to legally collected, authoritatively identified and properly documented specimens for use in their research and rest assured that their specimens rest safely in the AMCC cryo-storage room. For more details on the facilities see the AMCC website at: http://research.amnh.org/amcc/

Collecting expeditions typically consist of a series of excursions to selected habitats interspersed with breaks to catalogue and process the collected material. Sometimes insects are left in killing jars until they are processed, resulting in DNA degradation. To best retain traces of Wolbachia, insects should not be held without preservative. They should be transferred as soon as possible into 95% ethanol, or frozen at the collecting site. Strategies for both are suggested below.

 Back to the Top

This information can be seen in more details at: AMCC Field collection kits 

The AMCC will provide researchers of the FIBR Wolbachia project partner institutions with pre-labeled vials as well as dryshippers and an "electronic Field Collection Kit to facilitate the transfer of their samples at the AMCC.

Pre-labelled 1.8 ml vials, with AMCC label containing the AMCC number in both barcode and human readable format. These numbers are communicated to the researcher in an excel format spreadsheet as part of the "Electronic Field Collection Kit".

The vials can be either empty (for flash freezing in the field) or filled with buffer (when flash freezing in the field is not possible)

Electronic Field Collection kit

The electronic kit consists in:

- one excel spreadsheet template containing the AMCC numbers of the pre-labeled vials as well as template data fields from the AMCC database. For more on this, visit the AMCC electronic Field Collection kit page

Additional Field Equipment:

Dryshipper: The AMCC provides researchers with dry-shippers allowing control-rate freezing type of sample collecting in the field, as well as transfer from museum to museum, or donor to museum without ever thawing the specimens.

For more information on the dryshipper, see the AMCC Website

COLLECTING IN NITROGEN: Specimens may be frozen at the collecting site. Dead or stunned insects should be placed in cryotubes without buffer and placed in the cold dryshipper. The nitrogen-charged dryshipper can be obtained from the  AMCC. Go to  http://research.amnh.org/amcc/dryshipper_req.html to download a request form. (To stun an insect, squeeze its thorax while it is in the net, or keep it in the killing jar until it is subdued.) Butterflies may be placed in labeled glassine envelopes and placed into the dryshipper alive. Series of unidentified organisms may be separated into morpho-species and frozen if vouchers are preserved dry or in ethanol for later identification.

COLLECTING IN ETHANOL:  Plastic tubes containing 95% ethanol should be included in the collector’s field pack. 15ml and 50ml Falcon will hold ethanol without leaks or evaporation and are appropriate for short-term storage. They can be purchased from Fisher Scientific at www.fishersci.com. If large organisms, like tarantulas or horse lubber grasshoppers, are likely to be collected, 500ml Nalgene bottles should be included. NALGENE bottles are also available from Fisher. Insects can be pooled in dated, locality-labeled holding tubes, and held for a few days without sustaining damage. Kill and transfer the insects immediately to ethanol, or kill them directly in ethanol by tapping them into a wide-mouthed ethanol-filled tube. This works well for flies, beetles and bugs.

Identified specimens can be catalogued at the collection site by transferring them to permanent storage tubes. Empty or Ethanol-filled barcode-labeled AMCC cryotubes are recommended for this purpose. They can be obtained from jfstein@amnh.org at the AMCC. A limited number of tubes of a commercial preservative, RNA LATER, are also available for collection. (For more information, or to request field collecting kits, see below and visit http://research.amnh.org/amcc/). Right-in-the-rain weather-resistant field notebooks are recommended. They can be purchased from BioQuip at www.bioquip.com. If AMCC barcode-labeled tubes are used, the data can be simply referenced to the barcode number. Alternatively, electronic data records can be entered into an AMCC electronic spreadsheet supplied for this purpose. Host plant association is sometimes critical for the identification of insect species. When possible note the plant that the insect is on when collected, especially if it is feeding.

For species normally stored dry -- or that must be kept dry for identification -- like butterflies, it may be advisable to remove the genitalia at the collection site. Genitalia can be stored in ethanol or frozen (as explained below). The same reference number should be used to identify the genitalia and the rest of the insect, which may be kept for a pinned voucher. 

Ethanol preservation is not static and DNA will degrade in ethanol at room temperature over time. If a freezer is available, store the specimens at –4^oC (good) or –20^oC (better). WHEN THE SPECIMENS RETURN FROM THE FIELD THEY SHOULD BE HELD IN THE LAB FREEZER AT –20^oC until transfer to the AMCC. 

COLLECTING IN RNA LATER: If collecting in RNAlater samples should be treated in a manner that adheres to the following guidelines, RNAlater effectively deactivates all enzymatic activity (endo and exonuclease activity) for 24 hours at 37°C, 7 days at 18-25°C, 2 weeks at 4°C and indefinitely at -20°C. However if immediate refrigeration is available use it.  When collecting very large arthropods breaking open the exoskeleton just before submerging the insect may promote greater profusion of RNAlater through the tissue.

The post–collection RNAlater method suggested by the manufacturer is to store the samples at 4°C for at least 24 hours, then pellet down the sample, remove the RNAlater and either begin the extraction or store the dry samples in freezers.  For storage at -20°C, it is recommended that excess RNALater be removed from the sample to prevent crystallization of RNAlater and damage of the sample. For storage in cryogenic freezers at the AMCC, RNA later is drained away and the sample is stored dry.

Back to the Top

RECOMMENDED FIELD EQUIPMENT: 

From BIOQUIP: Insect Net, Aspirator (with extra vials), Long forceps (10”), Killing Jar (or materials for manufacture), Right-in-the-rain field notebooks, glassine envelopes for Lepidoptera.

From AMCC: Barcode-labelled cryotubes, field kits, nitrogen-charged dry shipper. Cryotubes are issued in boxes capable of holding 100 tubes. Each has a barcode and human-readable label and is issued with an electronic spreadsheet that may be printed for inclusion in the collector’s field kit, or used directly on a computer in the field. It is enough to write down the barcode number and the contents of the tube with locality and collection data.

From Fisher: Assorted plastic tubes capable of short-term ethanol storage without leaks or evaporation. 

Back to the Top

It is recommended that you accession your collected specimens at the AMCC as soon as possible (preferably directly after collection, or soon after if identification is required).

For collectors who have received an AMCC field kit, simply mail back the boxes of vials, or the dryshipper to the AMCC.

Send your electronic data file to the Collection Manager, Julie Feinstein (jfstein@amnh.org, 212 769 5663) who will acknowledge reception of your samples and data.

If you would like to send your samples, but have not requested a field kit prior to collecting, you may:

1. Request AMCC barcoded vials for you to transfer your own samples in the comfort of your own lab at your return from the field. Please remember to send the samples accompanying data electronically (excel spreadsheet). You may also request to have a dryshipper sent for the transfer of the samples from your institution to the AMCC.
2. Send the samples and their accompanying data (excel spreadsheet) in their original vials (we will transfer the samples ourselves, though it is not adviseable, as it adds time to the accessioning process into the collections)

Send your samples to the AMCC Collection Manager, Julie Feinstein (jfstein@amnh.org; 212 769 5663)

Back to the Top

Step 2: Pre-extraction processing

Methods for processing the arthropod prior to extraction vary depending on the morphological characteristics and size of the specimen. DNA can be extracted from either (1) eggs, ovaries, or testes, (2) whole abdomens, or (3) whole individuals (for small arthropods).  The tissues should be dissected in sterile, double-distilled, deionized water on a sterile Petri dish and then serially rinsed in droplets of sterile water prior to extraction of DNA.

Back to the Top 

Step 3: Extraction of arthropod and Wolbachia DNA

(We recommend using Qiagen kits for DNA extraction and purification)

DNA extraction and purification is completed using Qiagen kits containing a silica-gel-membrane which selectively binds the DNA while contaminants pass through.  One of two Qiagen kits can be used based on the size of the arthropod, the kits differ in the diameter of the membrane and the use of carrier RNA to optimize retrieval of DNA from the membrane during the final elution.

For small to large arthropod samples: Qiagen DNeasy kit

For very small (e.g. mites) arthropod samples: Qiagen QIAamp DNA Micro Kit

• Follow Protocol in Appendix G: Isolation of Genomic DNA from Insects.
• An optional RNase step can be done during homogenization, by adding 4µl of a 100mg/ml RNase solution.  Let the RNase and homogenate incubate for a 1-2 minutes before continuing with methods.
• If using the Qiagen QIAamp DNA Micro Kit and carrier RNA is required add 1ug to the 200ul of Buffer AL.
• Use the AE buffer (a.k.a. TE) to elute at the end.  If there is a concern that TE may interfere with sequencing reactions water can be used, but because of its sub-optimal pH (optimal pH is 7.5-8.5) all DNA will not be pulled off the membrane.  Therefore if yield is an issue a 5-10mM Tris solution can also be used in place of TE or water.
• In the last steps the number of elution done may vary with the size of the arthropod and quality of DNA. For large arthropods a 100-200 µl AE aliquot can be run through the membrane once or twice (i.e. elute with a 100-200µl of fresh AE and reuse that same 100-200µl AE for the second elution).  If the arthropod is very small (i.e. collembolan or mite) 20-50µl may be a more appropriate elution volume and the same aliquot can also be run through twice.

Back to the Top

Step 4: Diagnostic PCR reactions

Two diagnostic PCRs are done with primers amplifying a fragment of the 16s ribosomal RNA gene of Wolbachia and with universal arthropod primers amplifying a fragment of the D2 loop of the 28s ribosomal RNA gene.

The 16s rDNA Wolbachia primers

The 16s ribosomal RNA gene (~1600 base pairs) is frequently used in molecular phylogenies, due to the presence of highly conserved sequence regions that contain just enough variability to function as a good phylogenetic chronometer.  Within the Wolbachia genus there is some variation in the 16s sequences, but the 16s primers used for the diagnostic PCR were designed from highly conserved regions believed to be present in all Wolbachia strains, but divergent in related bacteria (e.g. Rickettsia, Anaplasma, and Cowdria). Base pair positions on the 16s gene are numerically standardized with base pair positioning on Escherichia coli.  The primers are robust and can anneal at a range of temperatures.

16s rDNA Wolbachia specific primers (438bp)

Forward 5’CAT ACC TAT TCG AAG GGA TAG (1004 position in E. coli)

Reverse 5’AGC TTC GAG TGA AAC CAA TTC (1442 position in E. coli)

16s rDNA Wolbachia specific primer protocol

PCR cycling conditions are a 2 minute pre-dwell at 94°C followed by 38 cycles of 30s at 94°C, 45s at 55°C, 1:30min at 72°C and a post-dwell period of 10 min at 72°C

The 28s rDNA universal arthropod primers

(template control PCR and arthropod sequence typing)

The 28s ribosomal RNA gene is universally present in eukaryotes and highly conserved.  The primers are designed from sequences [The National Center for Biotechnology information (NCBI)] from forty-three distinct species and tested on twenty-two different arthropod orders. They were created to universally amplify in arthropods and therefore effectively act as a control for the presence of amplifiable DNA.  They can also be used to sequence type positive (or negative) arthropods.  The primers begin at stem 8 of the 28s rRNA sequence, encompassing the D2 loop, and end in stem 13.  In Drosophila melanogaster the primers amplify a 443 base pair fragment but variability in the fragment length may be present in different arthropod orders.  Base pair positions on the 28s gene are numerically standardized with base pair positioning on the D. melanogaster 28 rRNA gene.  The primers are robust and can anneal at a range of temperatures.

28s D2 rDNA primers (~443bp)

(Ray Choudhury)

28sF3633 5’TACCGTGAGGGAAAGTTGAAA

28sR4076 5’AGACTCCTTGGTCCGTGTTT

28s D2 rDNA primer protocol

PCR cycling conditions are a 2 minute pre-dwell at 94°C followed by 38 cycles of 30s at 94°C, 50s at 58°C, 1:30min at 72°C and a post-dwell period of 10 min at 72°C

·      If Wolbachia 16s and arthropod 28s D2 diagnostic PCRs are positive the arthropod is scored as a positive for Wolbachia infection

·      If the Wolbachia 16s is positive and 28sD2 is negative the arthropod is scored as a positive for Wolbachia infection

·      If Wolbachia 16s is negative and arthropod 28s D2 is positive the arthropod is scored as a negative for Wolbachia infection

·      If Wolbachia 16s is negative and arthropod 28s D2 is negative then the DNA concentration in the PCR reaction should be varied. Testing a range of concentrations are recommended (e.g. 2-5x below and above) as both the presence of too little and two much DNA (or inhibitory substances) can prevent a successful reaction.  If retesting the sample at various concentrations continue to yield a negative for the 28s D2 rDNA PCR then the sample should be discarded from the analysis.

Back to the Top 

Step 5: Typing of Wolbachia strains A and B using two diagnostic PCRs with strain specific primers and/or the restriction profile (optional)

Based on 16s rRNA gene sequence differences, Wolbachia can be typed into six different groups or strains (A, B, C, D, E, and F).  The A and B strains are most frequently encountered and strain specific primers as well as differences in RsaI restriction profiles can be used to differentiate between the two groups.  Digestion of a Group B Wolbachia amplified 16s rDNA 438bp fragment results in five fragments of length 146, 165, 16, 67, 46, with only the 146 and 165 visible as overlapping bands at those positions.  Group A digestion results in a 311, 83, and 46 base pair fragments with only the 311 fragment visible.

16sA and 16sB specific primers (259bp)

(Werren, J. H., et al. 1995. Evolution and phylogeny of Wolbachia: reproductive paraites of arthropods. Proc. R. Soc. Lond. B 261:55-63.)

16sA strain specific rDNA Wolbachia primers

16sAf 5’TTCGGCCGGGTTTCACACAG

16sAr 5’TAAGGGATTAGCTTAGCCTC

16sB strain specific rDNA Wolbachia primers

16sBr 5’TAGGGATTAGCTTAGGCTTG

16sBf 5’TTCGGCCGGATTTTACACAA

16sA and 16sB specific primer protocol

PCR cycling conditions are a 2 minute pre-dwell at 94°C followed by 38 cycles of 30s at 94°C, 50s at 55°C, 1:30min at 72°C and a post-dwell period of 10 min at 72°C

Restriction profile (RsaI)

(Werren, J.H., and Windsor, D.M. 2000. Wolbachia infection frequencies in insects: evidence of a global equilibrium? Proc. R. Soc. Lond. B 267:277-1285)

Reaction mix (20ul):

15 ul PCR reaction

2ul buffer (appropriate to enzyme)

3ul water

1ul RsaI enzyme

Digest for at least two hours at temperature appropriate to enzyme

Back to the Top

Step 6: Sequencing of Wolbachia infected arthropod 28s D2 PCR product for molecular identification of arthropod and 16s, wsp or other Wolbachia genes for strain typing in Wolbachia (optional)

Host Sequence Typing

Sequencing of the arthropod’s 28s D2 region provides an identification sequence for the insect, which can be very useful.  We will be accumulating a data base of 28s D2 rDNA sequences for the project, to augment what is already available at NCBI.  In addition primers for mitochondrial sequencing typing and a single copy nuclear gene (forkhead) are provided.  The sequence amplified using the mitochondrial cytochrome c oxidase subunit I, 5’ segment (COI-5’) primers, listed below, are used as bar coding primers by the American Museum of Natural History (AMNH) and if using the AMNH for sample storage sequencing of this fragment is encouraged.

Mitochondrial cytochrome c oxidase subunit I, 5’ segment (COI-5’).

(Hebert, P.D.N., et. al. Biological Identification through DNA Barcodes. Proc. R. Soc. Lond. B 270:313-322.)

These are broad range primers that will amplify an ~700bp segment from diverse invertebrates

COI-5’f5’GGTCAACAAATCATAAAGATATTGG

COI-5’r5’TAAACTTCAGGGTGACCAAAAAATCA

COI-5’ primer protocol

PCR cycling conditions are a 2 minute pre-dwell at 94°C followed by 38 cycles of 30s at 94°C, 50s at 55°C, 1:30min at 72°C and a post-dwell period of 10 min at 72°C

ForkHead: Single copy Nuclear gene

The Forkhead (fkh) gene is one of a few genes involved in the terminal pattern cascade in insects, which helps form the terminal cuticle structures.

ForkHead: Single copy Nuclear gene

fkh F 5’CC TAC TCC TAC ATC TCC CTGATHACNATGGC

fkh R 5’C GCA GGT AGC AGC CGT TYT CRAACATRT

Forkhead primer protocol

PCR cycling conditions are a 2 minute pre-dwell at 94°C followed by 38 cycles of 30s at 94°C, 50s at 52/53°C, 1:30min at 72°C and a post-dwell period of 10 min at 72°C

Back to the Top  

Wolbachia Sequence Typing

Eventually we will have a set of Wolbachia genes for PCR amplification to do Multi Locus Strain Typing (MLST) of the Wolbachia.  The protocol will be updated accordingly when this information is available.

In the mean time, we recommend sequencing the Wolbachia surface protein gene (wsp), heat shock protein (groEL), and the portion of 16s rRNA gene amplified by the general primers described in step 4.  The 16S region is not highly variable, but can be informative.  The wsp and groEL genes are much more variable.  Sequence files with aligned wsp, groEL and 16s rDNA (and additional genes as they are added) can be provided if needed.

Note that if the arthropod is doubly infected with both A and B Wolbachia strains, both A and B specific primers must be used for these genes.  It is also possible to have multiple B infections and these will show up as multiple peaks at certain base positions.  If doing direct sequencing from the PCR products it may be easiest to simply do the direct PCR amplification and see if this is an issue.  If it is a problem, then use of the group specific primes and or cloning and sequencing may be necessary.

Wolbachia wsp primers

(Zhou, W., et al. 1998. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. Proc. R. Soc. Lond. B 265:509-515)

The wsp gene is a single copy gene coding for an outer membrane protein of Wolbachia and these types of genes are generally highly variable.  Primers and pcr conditions for amplification of the wsp fragment are shown below.  Primers are numbered based on the wRi wsp gene sequence corresponding to the 5’ base.  Position 1 is equivalent to the first base of the coding region of the wRi wsp gene.

Wolbachia wsp primers

wsp81f 5’TGG TCC AAT AAG TGA TGA AGA AAC

wsp691r 5’AAA AAT TAA ACG CTA CTC CA

Wolbachia wsp A specific forward primers

Wsp136Af 5’TGAAATTTTACCTCTTTTC

wsp691r 5’AAA AAT TAA ACG CTA CTC CA

Wolbachia wsp B specific reverse primers

wsp81f 5’TGG TCC AAT AAG TGA TGA AGA AAC

wsp522Br 5’ACCAGCTTTTGCTTGATA

Wolbachia wsp general, A, and B primers protocol

PCR cycling conditions are a 2 minute pre-dwell at 94°C followed by 38 cycles of 1min at 94°C, 1min at 55°C, 1min at 72°C and a post-dwell period of 10 min at 72°C

Wolbachia GroEL primers

(Casiraghi, M. et al. Phylogeny of Wolbachia based on gltA, groEL and ftsZ gene sequences: clustering of arthropod and nematode symbionts in the F supergroup and evidence for two further supergroups. (In preparation))

The nucleotide sequences (534 to 546 bp) of the groEL gene, encodes the 60-kDa heat shock protein.  In comparison with 16S rRNA gene the groEL gene has a higher degree of divergence within the Wolbachia.  The Wolbachia groEl general primers were designed as degenerate primers for two reasons (1) they will work with all potential Wolbachia sequences (including filarid nematodes) and (2) the regions they amplify are the limits of the gene so that a long fragment is produced for sequencing.

Wolbachia groEl general primers

groELf: 5'GGT GAG CAG TT(GA) CA(GA) (CG)AA GC
groELr: 5'AG(GA) TCT TCC AT(CT) TT(AG) ATT CC

Wolbachia groEl group B specific primers

To amplify B sequences you can either use couples of B-specific primers(e.g. B-specific forward with a B-specific reverse), or mixed couples (e.g. general forward with a B-specific reverse).  These primers have only been used on Nasonia wasps so the breadth with which they function still needs testing.

groELBf1 5'AAT TAG YAA GCC ATA TGG WGG (Tm 57)

groELBr1 5'AGA CCA CGY AAT TTG TTG ATC (Tm 59)

groELBf2 5'CAG AGG TYA CAA AGG ATG GC (Tm 62)
groELBr2 5'AAT GCT TCA CCT TCA ACA TCT (Tm 60)

Wolbachia groEL general and B group specific primer protocol

PCR cycling conditions are a 2 minute pre-dwell at 94°C followed by 38 cycles of 30s at 94°C, 45s at 55°C, 1:30min at 72°C and a post-dwell period of 10 min at 70°C

Group A specific groEL primers are currently under development.

Back to the Top